View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3299_high_14 (Length: 226)
Name: NF3299_high_14
Description: NF3299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3299_high_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 44131675 - 44131450
Alignment:
| Q |
1 |
ttgaaacgaacttaaaaaacaatttatttcatatctcaaattgggccaccactaaaaatcccatttccccaacaccctatgctacaaatactatctgctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44131675 |
ttgaaacgaacttaaaaaacaatttatttcatatctcaaattgggccaccactaaaaatcccatttccccaacaccctatgctacaaatactatctgctc |
44131576 |
T |
 |
| Q |
101 |
tcaacaaacacaagccaacgtggctaaagtggagagtgcatggcactctgatacgagacatcagacatgataagatctttgacaaatagttgttgcggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44131575 |
tcaacaaacacaagccaacgtggctaaagtggagagtgcatggcactctgatacgagacatcagacatgataagatctttgacaaatagttgttgcggta |
44131476 |
T |
 |
| Q |
201 |
tgaactcaaatcacgcaccgtgcttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44131475 |
tgaactcaaatcacgcaccgtgcttg |
44131450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University