View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3299_high_3 (Length: 366)
Name: NF3299_high_3
Description: NF3299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3299_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 350
Target Start/End: Original strand, 45540988 - 45541334
Alignment:
| Q |
1 |
cccgccgatacaattgatggagcgtccaagtgaaaatgtgactaatgcccaatatgtctttccatctcatgtatttgctagaaacaatacaaatgcccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540988 |
cccgccgatacaattgatggagcgtccaagtgaaaatgtgactaatgcccaatatgtctttccatctcatgtatttgctagaaacaatacaaatgcccca |
45541087 |
T |
 |
| Q |
101 |
gtagaatggagcactgcctctaacgaatcactcttcagcatttatatgggaaatacaagtttctcaagtgaactagcttgcttcaaatcttcttctgatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45541088 |
gtagaatggagcactgcctctaacgaatcactcttcagcatttatatgggaaatacaagtttctcaagtgaactagcttgcttcaaa---tcttctgatt |
45541184 |
T |
 |
| Q |
201 |
tagataagtctggtgatgtatatatgtccgatcagcatattgcttcgccaaatcatcaacctccagtacctgtgaataaattcaacgctataagcaaggg |
300 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45541185 |
tagataagtctggtgatgtatgtatgtccgatcagtatattgcttcgccaaatcatcaacctccagtacctgtgaataaattcaacgctattagcaaggg |
45541284 |
T |
 |
| Q |
301 |
aactgccgaacttcacgaagaaggtttgaaggtaactgaagcaaaagctg |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541285 |
aactgccgaacttcacgaagaaggtttgaaggtaactgaagcaaaagctg |
45541334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University