View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3299_high_6 (Length: 250)
Name: NF3299_high_6
Description: NF3299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3299_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 36 - 187
Target Start/End: Complemental strand, 53554273 - 53554122
Alignment:
| Q |
36 |
ataattcttactctttaagatcattctattggtttgtcttgaacatgaatttgagctatatctgttttgaggtgttgggtttctgatgcttaatgtttat |
135 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
53554273 |
ataattcttgcactttaagatcattctattggtttgtcttgaacatgaatttgagctatatctgctttgaggtgatgggtttctaatgcttaatgtttat |
53554174 |
T |
|
| Q |
136 |
atgtaaaataaattttacaagaagatttttaatttcactattaggatttttt |
187 |
Q |
| |
|
|||||||||||||||||||||| || ||||| ||||| ||||| | |||||| |
|
|
| T |
53554173 |
atgtaaaataaattttacaagaggacttttagtttcattattacggtttttt |
53554122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 125 - 186
Target Start/End: Original strand, 13928680 - 13928742
Alignment:
| Q |
125 |
ttaatgtttatatgtaaaataaattttacaagaagatttttaatttcactatt-aggattttt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||| |
|
|
| T |
13928680 |
ttaatgtttatatgtaaaataaattttacaagaagacttttaatttcaatattaaggattttt |
13928742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University