View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3299_low_11 (Length: 238)

Name: NF3299_low_11
Description: NF3299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3299_low_11
NF3299_low_11
[»] chr7 (1 HSPs)
chr7 (1-222)||(44131063-44131284)


Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 44131284 - 44131063
Alignment:
1 cttgtccagaagttaaggcaaataccaagtctggattatttagcagtacggcaagcaactgcatgtcaggttgagcagttgctgcattactggctgaaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44131284 cttgtccagaagttaaggcaaataccaagtctggattatttagcagtacggcaagcaactgcatgtcaggttgagcagttgctgcattactggctgaaga 44131185  T
101 tgaggaggccaccccttgaacagcagcatgagttgcaacttgatcagatgcatccatttctacgtcgtcacaatctggtagctgttcaataggaatttcc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44131184 tgaggaggccaccccttgaacagcagcatgagttgcaacttgatcagatgcatccatttctacgtcgtcacaatctggtagctgttcaataggaatttcc 44131085  T
201 aatgtcaaagaatcatcgtagt 222  Q
    | ||||||||||||||||||||    
44131084 agtgtcaaagaatcatcgtagt 44131063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University