View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3299_low_15 (Length: 223)
Name: NF3299_low_15
Description: NF3299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3299_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 13148817 - 13148614
Alignment:
| Q |
1 |
ttaatttattttaaaataaattaataaacagatgttgcttaaatgatacccgtactcaacgaaactccaagatacctaagaatttccttttcnnnnnnna |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||| ||| | |
|
|
| T |
13148817 |
ttaatttattttaaaataaattaataaacaaatgttgcttaaatgatatccgtactcaacgaaactctaagatacctaaaaatttcccttt--ttttaaa |
13148720 |
T |
 |
| Q |
101 |
aaaataattctaatttttgtattagcaaacacataacattaccacttcattaaaattagtcatgtgaccgatttttagtcaaaatatgcaaggactacca |
200 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13148719 |
aaaataattctaatttttatattggcaaacacataacattgccacatcattaaaattagtcatgtgaccgatttttagtcaaaatatgcaaggactacca |
13148620 |
T |
 |
| Q |
201 |
agtaca |
206 |
Q |
| |
|
|||||| |
|
|
| T |
13148619 |
agtaca |
13148614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University