View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3300_high_13 (Length: 307)
Name: NF3300_high_13
Description: NF3300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3300_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 20 - 299
Target Start/End: Original strand, 11238967 - 11239246
Alignment:
| Q |
20 |
gctctctctcttttcgttgtattttcagttgcagannnnnnnnacaaccgccatgaccaatttgtgaaggatggcggtgccacgg-tgttttatggtgga |
118 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
11238967 |
gctctctcttttttcgttgcattttcagtggcagattttttt-acaaccgccatgaccaatttgtgaaggatggcggtgccacgggtgttttatggcgga |
11239065 |
T |
 |
| Q |
119 |
taaatattacttttgggaggttgactttcttcctaggattttaattagtttttgaatattcaagtatacaacattgtaatgatgtgatgaactataaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11239066 |
taaatattacttttgggaggttgactttcttcctaggattttaattagtttttgaatattcaagtatacaacattgtaatgatgtgatgaactataaatt |
11239165 |
T |
 |
| Q |
219 |
ctatattttttatcattaggaatcgaactcgttaccctggtgttcttgacagttctttttctgtcacttcccgcctatgct |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
11239166 |
ctatattttttatcattaggaatcgaactcgttaccctggtgttcttgacagttctttttctgtcacttccctcccatgct |
11239246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 63 - 101
Target Start/End: Complemental strand, 52584459 - 52584421
Alignment:
| Q |
63 |
acaaccgccatgaccaatttgtgaaggatggcggtgcca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584459 |
acaaccgccatgaccaatttgtgaaggatggcggtgcca |
52584421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 68 - 117
Target Start/End: Original strand, 46864440 - 46864489
Alignment:
| Q |
68 |
cgccatgaccaatttgtgaaggatggcggtgccacggtgttttatggtgg |
117 |
Q |
| |
|
||||||| |||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
46864440 |
cgccatggccaatttgtgaaggatggcgacgccatggtgttttatggtgg |
46864489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 63 - 119
Target Start/End: Original strand, 30750036 - 30750092
Alignment:
| Q |
63 |
acaaccgccatgaccaatttgtgaaggatggcggtgccacggtgttttatggtggat |
119 |
Q |
| |
|
|||||||||| | |||||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
30750036 |
acaaccgccacggccaatttgtgaaagatggcggtgccatggtgttctatggtggat |
30750092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 63 - 120
Target Start/End: Complemental strand, 5043961 - 5043904
Alignment:
| Q |
63 |
acaaccgccatgaccaatttgtgaaggatggcggtgccacggtgttttatggtggata |
120 |
Q |
| |
|
|||||| |||||| ||||| ||||| ||||||||||||| ||||||| |||||||||| |
|
|
| T |
5043961 |
acaaccaccatgatcaattcgtgaacgatggcggtgccatggtgtttcatggtggata |
5043904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 71 - 119
Target Start/End: Original strand, 2348543 - 2348591
Alignment:
| Q |
71 |
catgaccaatttgtgaaggatggcggtgccacggtgttttatggtggat |
119 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
2348543 |
catggccaatttgtgaaggatggcagtgccctggtgttttatggaggat |
2348591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University