View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3300_low_14 (Length: 328)
Name: NF3300_low_14
Description: NF3300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3300_low_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 9 - 328
Target Start/End: Complemental strand, 34167152 - 34166833
Alignment:
| Q |
9 |
acatcatcatgcctaggacgcaacattttagtttgtacctttactgatgggtnnnnnnnncacatttatcaggttataatatcatcctaggtttgagtct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34167152 |
acatcatcatgcctaggacgcaacattttagtttgtacctttactgatgggtaaaaaaaacacatttatcaggttataatatcatcctaggtttgagtct |
34167053 |
T |
 |
| Q |
109 |
aagtcgtccccgacaaactggcttaaatgctgaggattgtctaccctttataagcnnnnnnnnagtccatttctctagtaggatcacgacaaccttctaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34167052 |
aagtcgtccccgacaaactggcttaaatgctgaggattgtctaccctttataagcttttttttagtccatttctctagtaggatcacgacaaccttctaa |
34166953 |
T |
 |
| Q |
209 |
tttcactcaagaaataaattacgtcattggaaagtttaattagctaaaaattcataagttggacatactctcccagtgtagagctaaaagttccagactc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34166952 |
tttcactcaagaaataaattacgtcattggaaagtttaattagctaaaaattcataagttggacatactctcccagtgtagagctaaaagttccagactc |
34166853 |
T |
 |
| Q |
309 |
ttgcattctctgttcatctc |
328 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
34166852 |
ttgcattctctgttcttctc |
34166833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University