View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3301_high_17 (Length: 251)
Name: NF3301_high_17
Description: NF3301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3301_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 31242000 - 31242217
Alignment:
| Q |
1 |
ttagcaccctctttaagtaatttagaaggaaattcttcatttaattgtttatatcgagcaagacttgattgttgttgtatttattgatggggttttaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31242000 |
ttagcaccctctttaagtaatttagaaggaaattcttcatttaattgtttatatcaagcaagacttgattgctgttgtatttattgatggggttttaaaa |
31242099 |
T |
|
| Q |
101 |
attatatgttatcatacnnnnnnnnnnnnnnnnnngagtaaactcacgtgtatccttaatatttttaaatgatcacttataaacattggcggaactacgt |
200 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31242100 |
attatatgttatcattcttttttaattttgtttttaggtaaactcacgtgtatccttaatatttataaatgatcacttataaacattgacggaactacgt |
31242199 |
T |
|
| Q |
201 |
tgccagctctgtaggcac |
218 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
31242200 |
tgtcagctctgtaggcac |
31242217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 227
Target Start/End: Original strand, 31290449 - 31290489
Alignment:
| Q |
187 |
tggcggaactacgttgccagctctgtaggcacgtgccccca |
227 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
31290449 |
tggcggagctacgttgccaactctgcaggcacgtgccccca |
31290489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University