View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3301_high_18 (Length: 250)
Name: NF3301_high_18
Description: NF3301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3301_high_18 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 37928120 - 37928359
Alignment:
| Q |
11 |
cagagagagagctatgccgaagcttttgttaagcatcaacaacgatatagctgcagagtggacgagtggaaggctgctctaaaccaagtagctggactct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37928120 |
cagagagagagctatgccgaagcttttgttaagcatcaacaacgatatagctgcagagtggacgagtggaaggctgctctaaaccaagtagctggactct |
37928219 |
T |
 |
| Q |
111 |
caggctgggattcacaagtaaccaggtcagtcactattttctttacatgcacttgacattaatactcaggctgggattcaaaggtggttttgttatttac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37928220 |
caggctgggattcacaagtaaccaggtcagtcactattttctttacatgcacttgacattagtactcaggctgggattcaaaggtggttttgttatttac |
37928319 |
T |
 |
| Q |
211 |
atgaaatattatctatgatttaagcaaatccatcataatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37928320 |
atgaaatattatctatgatttaagcaaatccatcataatt |
37928359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 77 - 133
Target Start/End: Original strand, 25720620 - 25720676
Alignment:
| Q |
77 |
tggaaggctgctctaaaccaagtagctggactctcaggctgggattcacaagtaacc |
133 |
Q |
| |
|
||||||| |||||||| |||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
25720620 |
tggaaggatgctctaactcaagtagctggactgtcaggatgggattcacaagtaacc |
25720676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University