View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3301_high_25 (Length: 236)
Name: NF3301_high_25
Description: NF3301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3301_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 36475361 - 36475289
Alignment:
| Q |
1 |
ataaaattcatatagacaattgtaattggtgtatataatttatttagtggatccaatttgtattctaattatt |
73 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36475361 |
ataaaattcatatggacaatagtaattggtgtatataatttatttagtggatccaatttgtattctaactatt |
36475289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 187
Target Start/End: Complemental strand, 36475237 - 36475207
Alignment:
| Q |
157 |
agcacatctaagttgacatggacaatacaat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36475237 |
agcacatctaagttgacatggacaatacaat |
36475207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University