View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3301_low_20 (Length: 246)
Name: NF3301_low_20
Description: NF3301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3301_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 8134349 - 8134598
Alignment:
| Q |
1 |
aagaaaaatgttaattttggggaacatttaacttaaaaaggtcgatgttaaggcttaattaggctgctattaaacctcgtaattttatcataagtgtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||| || ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
8134349 |
aagaaaaatgttaattttggggaacatt-aacttgaaaaagttgatgttaaggcttaattaggctgctgttaaacctcgtaattgtatcataagtgtgtt |
8134447 |
T |
|
| Q |
101 |
t------------ccgcatctttgtcttgtggttgtaaccgtccaagttcatgtagcaacctgcgatggtgcaaatcatgttaagtcacacacctgtagc |
188 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8134448 |
atccgcttgattgccgcatctttgtctcgtggttgtaaccgtccaagttcatgtagcaacctgcgatggtgcaaatcatgttaagtcacacacctgtagc |
8134547 |
T |
|
| Q |
189 |
ttgtttgttgaccatatttagtaccgagatttctgattgaatatatctctg |
239 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
8134548 |
ttgtttgttgaccatatttattaccgagatttctgattgaatatatgtctg |
8134598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University