View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3301_low_26 (Length: 230)
Name: NF3301_low_26
Description: NF3301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3301_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 3558098 - 3557897
Alignment:
| Q |
18 |
aattatacccttctcttccacttactctagaaaccactctagatgttaaataaggaccattatgcccccacttgttaccatcaaaagtaagtgcaaattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3558098 |
aattatacccttctcttccacttactctagaaaccactctagatattaaataaggaccattatgcccccacttgttaccatcaaaagtaagtgcaaattc |
3557999 |
T |
 |
| Q |
118 |
ctcaataaacttcaaaagcaaagggtgttttttatcaaatatcaacacagcattgttcaaacgactccatttctttgttttcacatcaatgttctgtgct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3557998 |
ctcaataaacttcaaaagcaaagggtgttttttatcaaatatcaacacagcattgttcaaacgactccatttctttgttttcacatcaatgttctgtgct |
3557899 |
T |
 |
| Q |
218 |
cc |
219 |
Q |
| |
|
|| |
|
|
| T |
3557898 |
cc |
3557897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University