View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3301_low_27 (Length: 217)
Name: NF3301_low_27
Description: NF3301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3301_low_27 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 30 - 217
Target Start/End: Complemental strand, 41403996 - 41403815
Alignment:
| Q |
30 |
tatatcatatgaaattttgttttgtaaatatcgtcaaagtaattaataactactacatcattttttatnnnnnnnnnnnnnnnnnntcaactttttaatt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41403996 |
tatatcatatgaaattttgttttgtaaatatcgtcaaagtaat----aactactacatcattttttataaaataaaataaaaaaa--caactttttaatt |
41403903 |
T |
 |
| Q |
130 |
tcttaaacatttgtcataatgatgtttgttagcaatatcttgtttttgttaatttatctagaacaatatatcagacgggatgcatcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41403902 |
tcttaaacatttgtcataatgatgtttgttagcaatatcttgtttttgttaatttatctagaacaatatatcagacgggatgcatcat |
41403815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University