View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3303_high_3 (Length: 234)

Name: NF3303_high_3
Description: NF3303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3303_high_3
NF3303_high_3
[»] chr7 (1 HSPs)
chr7 (63-220)||(45323836-45323993)


Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 63 - 220
Target Start/End: Original strand, 45323836 - 45323993
Alignment:
63 ccgaggtagtgtcatcaattgccatcaactttggaatcctacgcaacgatatatgtttttcggcgggaacattggaacaataattatgctgnnnnnnnnc 162  Q
    |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||        |    
45323836 ccgaggtagtgttatcaattgccatcaactttggaatcctacgcaaccatatatgtttttcggcgggaacattggaacaataattatgatgttttttttc 45323935  T
163 ttaaattaatgtgtttctgcgccttttaaccgtggaaactaatctcacgtgacaattt 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45323936 ttaaattaatgtgtttctgcgccttttaaccgtggaaactaatctcacgtgacaattt 45323993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University