View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3303_high_4 (Length: 211)
Name: NF3303_high_4
Description: NF3303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3303_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 45323478 - 45323294
Alignment:
| Q |
18 |
gtcaattctatggatgaagaagaagaagggaatgtggtgttattaggtgttggtgaagcgttgttctgatgttagtgctatgattagagcgaaggctttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45323478 |
gtcaattctatggatgaagaagaagaagggaatgtggtgttattaggtgttggtgaagcgttgttctgattttagtgctatgattagagcgaaggctttg |
45323379 |
T |
 |
| Q |
118 |
ccgagtttggcgcaggttcttaggtttttatcaggtaatgataaggctagtgtggttttgaaagagtttttgggttttgatgatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45323378 |
ccgagtttggcgcaggttcttaggtttttatcaggtaatgataaggctagtgtggttttgaaagagtttttgggctttgatgatg |
45323294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 67 - 202
Target Start/End: Complemental strand, 14239302 - 14239167
Alignment:
| Q |
67 |
ttggtgaagcgttgttctgatgttagtgctatgattagagcgaaggctttgccgagtttggcgcaggttcttaggtttttatcaggtaatgataaggcta |
166 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||| | | | || || ||| | ||||||||||| || ||||||||||||||| ||| ||||||| |
|
|
| T |
14239302 |
ttggtgaagcgttgttcggatgttagtgctacgattcgcgggcgagcgatgtcgactctggcgcaggttgttgggtttttatcaggtagtgaaaaggcta |
14239203 |
T |
 |
| Q |
167 |
gtgtggttttgaaagagtttttgggttttgatgatg |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
14239202 |
gtgtggttttgaaagagtttatgggttttggtgatg |
14239167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University