View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3303_low_3 (Length: 234)
Name: NF3303_low_3
Description: NF3303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3303_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 63 - 220
Target Start/End: Original strand, 45323836 - 45323993
Alignment:
| Q |
63 |
ccgaggtagtgtcatcaattgccatcaactttggaatcctacgcaacgatatatgtttttcggcgggaacattggaacaataattatgctgnnnnnnnnc |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
45323836 |
ccgaggtagtgttatcaattgccatcaactttggaatcctacgcaaccatatatgtttttcggcgggaacattggaacaataattatgatgttttttttc |
45323935 |
T |
 |
| Q |
163 |
ttaaattaatgtgtttctgcgccttttaaccgtggaaactaatctcacgtgacaattt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45323936 |
ttaaattaatgtgtttctgcgccttttaaccgtggaaactaatctcacgtgacaattt |
45323993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University