View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3304_high_13 (Length: 314)
Name: NF3304_high_13
Description: NF3304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3304_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 32373986 - 32374293
Alignment:
| Q |
1 |
aaaaccaactgccattagtttacctgatagaaattgtacgaatcattttcctttgcatctccaatgccatttgaatgcccttgaatacaatttttctctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373986 |
aaaaccaactgccattagtttacctgatagaaattgtacgaatcattttcctttgcatctccaatgccatttgaatgcccttgaatacaatttttctctt |
32374085 |
T |
|
| Q |
101 |
catatgaagaagacaaagttatctccttctcagctagtaccttgtccacatccaaagtttcatcctgacagattccagcagttgatttatccaatattac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32374086 |
catatgaagaagacaaagttatctccttctcagctagtaccttgtccacatccaaagtatcatcctgacaggttccagcagttgatttatccaatattac |
32374185 |
T |
|
| Q |
201 |
aaccttactttgatcggggaaatcagtggaggaagttcttgatccattagaacagctttcgtcatcactatcccaagcatttgtagatattgatggggtc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32374186 |
aaccttactttgatcggggaaatcagtggaggaagttcttgatccattagaacagctttcgtcatcactatcccaagcatttgtagatattgatggggtc |
32374285 |
T |
|
| Q |
301 |
tgtggtgc |
308 |
Q |
| |
|
|| ||||| |
|
|
| T |
32374286 |
tggggtgc |
32374293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University