View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3304_high_9 (Length: 328)
Name: NF3304_high_9
Description: NF3304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3304_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 29422876 - 29423193
Alignment:
| Q |
1 |
aatctggatcaggtgaatgcgttgccggttgttggagaatttgtgaatgacagcctccctgtagttgagtcggaaagttcatttagtcaaggtaaatact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29422876 |
aatctggatcaggtgaatgcgttgccggttgttggagaatttgtgaatgacagcctccctgtagttgagtcggaaagttcatttagtcaaggtaagtact |
29422975 |
T |
|
| Q |
101 |
tggtttatgtgggtggtggagataggtgtaagagcatgaatcatttcttgtggagtttcttgtgtgctctaggagaagctcagtacctaaaccgaacatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29422976 |
tggtttatgtgggtggtggagataggtgtaagagcatgaatcatttcttgtggagtttcttgtgtgctctaggagaagctcagtacctaaaccgaacatt |
29423075 |
T |
|
| Q |
201 |
ggttatggatttgagcatatgtctgtcttcgatttacacttcatcgaagcaggatgaggaaggcaaagattttagattttactttgattttgagcatttg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29423076 |
ggttatggatttgagcatatgtctgtcttcgatttacacttcatcgaagcaggatgaggaaggcaaagattttaggttttactttgattttgagcatttg |
29423175 |
T |
|
| Q |
301 |
aaggaggcggcgtctgtg |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29423176 |
aaggaggcggcgtctgtg |
29423193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 253 - 307
Target Start/End: Complemental strand, 35558920 - 35558866
Alignment:
| Q |
253 |
gatgaggaaggcaaagattttagattttactttgattttgagcatttgaaggagg |
307 |
Q |
| |
|
||||| ||||| || |||||||| | ||||||||||||||| ||||||||||||| |
|
|
| T |
35558920 |
gatgaagaagggaaggattttaggtattactttgattttgaacatttgaaggagg |
35558866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University