View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3304_low_1 (Length: 301)
Name: NF3304_low_1
Description: NF3304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3304_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 270
Target Start/End: Original strand, 10827883 - 10828140
Alignment:
| Q |
18 |
gtttcagaacccattctttttactctatcttttttgttcttctcaaaatagaaagaattgaaatggaagtgttatggttaattttagaagaatgaaaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
10827883 |
gtttcagaacccattctttttactctatcttttttgttcttctcaaaatagaaagaattgaaatggaagtgtaatggttaattttagaagaatgaaaacg |
10827982 |
T |
 |
| Q |
118 |
gaaaacggttaaggtggagatctcacattcactatggcagaattgtatccacattctaagacacgtgtgtacacaactgacatgtgtcact-----tatc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10827983 |
gaaaacggttaaggtggagatctcacattcactatggcagaattgtatccacattctaagacacgtgtgtacacaactgacatgtgtcactttaactatc |
10828082 |
T |
 |
| Q |
213 |
ttaggtagtagaattcaattactgaattaaatctgatgaaaccatacgtgaatttatt |
270 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| |||||||| ||||||||||| |
|
|
| T |
10828083 |
ttaggtagtagaattcaattactgagttaaatttgataaaaccatatgtgaatttatt |
10828140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University