View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3305_high_4 (Length: 467)
Name: NF3305_high_4
Description: NF3305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3305_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 16 - 460
Target Start/End: Complemental strand, 39276347 - 39275906
Alignment:
| Q |
16 |
caaaataaagtcgaggtcatttgcacaattataccgagtgggattgccaacttttaatgtattattttcccttttcttagattatttttgttagcagcta |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276347 |
caaaataaagtagaggtcatttgcacaattataccgagtgggattgccaactttttatgtattattttcccttttcttagattatttttgttagcagcta |
39276248 |
T |
 |
| Q |
116 |
tcataacttcctctttttcactctgcatcannnnnnnatattatacatctaaactatttccttttgctccctaaacattgctgcatctttccctttaaaa |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276247 |
tcataacttcctttttttcactctgcatcatttttttatattatacatctaaactatttccttttgctccctaaacattgctgcatctttccctttaaaa |
39276148 |
T |
 |
| Q |
216 |
tttatagatatataatgaagtataactaataaaaagttttggtagaattcttaaggatcatgacctagatattgcctgcccatcacaaatcttttnnnnn |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39276147 |
tttatagatatataatgaagtataactaataaaaagttttggtagaattcttaaggatcatgacctagatat----tgcccatcacaaatcttttaaaaa |
39276052 |
T |
 |
| Q |
316 |
nnntgccaatcacaatcacaatgttttggttc-tttttcgggtgatccaatgatctatttttaagttggttgtctcactaatatggcatcattgaggctg |
414 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276051 |
aaatgccaatcacaatcacaatgttttggttcttttttcgggtgatccaatgatctatttttaagttggttgtctcactaatatggcatcattgaggctg |
39275952 |
T |
 |
| Q |
415 |
ctgtcttaaatttggctaattaaacttaaaactatgttctgtgctg |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39275951 |
ctgtcttaaatttggctaattaaacttaaaactatgttctgtgctg |
39275906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University