View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3305_low_16 (Length: 235)
Name: NF3305_low_16
Description: NF3305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3305_low_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 5 - 235
Target Start/End: Original strand, 34306115 - 34306324
Alignment:
| Q |
5 |
caaaaatgactgaaaatattacattttttgtaattcttggcagtgtagtggtgctacaatttttggaacacaatgaccaccttcattcctttggaaactt |
104 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306115 |
caaaaatgactgaaaatattacatttt-tgtaattcttggcagtgtagtggtgctacaatttttggaacacaatgaccaccttcattcctttggaaactt |
34306213 |
T |
 |
| Q |
105 |
tcagcagagcccaaatgcatgtgtatgggaaaaatcgacttgtaaatatggtaattgtctaaggtatgctagctctattttgatcttatacgcaagttgg |
204 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34306214 |
tcagcagagcccaaat--------------------gacttataaatatggtaattgtctaaggtatgctagctctattttgatcttatatgcaagttgg |
34306293 |
T |
 |
| Q |
205 |
gacttaggctttttcaatactcccaaaatgc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34306294 |
gacttaggctttttcaatactcccaaaatgc |
34306324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University