View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306-Insertion-15 (Length: 161)
Name: NF3306-Insertion-15
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306-Insertion-15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 44795275 - 44795428
Alignment:
| Q |
8 |
tcattctcatagatagagggttagggtttttgaaaacctctccaatgttgtttttacgacactaatgtatcgtattcgtctccttcattctttctccgtt |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44795275 |
tcattctcatagagagagggttagggtttttgaaaacctctccaatgttgtttttacgacactaatgtatcgtattcgtctccttcattctttctccgtt |
44795374 |
T |
 |
| Q |
108 |
gcttttctgtactggttttacgtcttttcataagcagctttctctaaatcgctt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44795375 |
gcttttctgtactggttttacgtcttttcataagcaactttctctaaatcgctt |
44795428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University