View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306-Insertion-3 (Length: 627)
Name: NF3306-Insertion-3
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306-Insertion-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 5e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 433 - 504
Target Start/End: Original strand, 42031532 - 42031603
Alignment:
| Q |
433 |
cttgtgttacagaacatttctctagaatggaaatatgagaatggatattttcatttttatattagtacatca |
504 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42031532 |
cttgtgttacagaacatttctctagaatggaaatatgagaatggatgttttcatttttatattagtacatca |
42031603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 571 - 627
Target Start/End: Original strand, 42031670 - 42031726
Alignment:
| Q |
571 |
cggatttacttcgacataaggtggtttctttgaaggtgtttttacttgcttgacgtc |
627 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42031670 |
cggatttactttgacataagacggtttctttgaaggtgtctttacttgcttgacgtc |
42031726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 250 - 351
Target Start/End: Original strand, 27910902 - 27911003
Alignment:
| Q |
250 |
atgatgtttggatctcttaatgggaaatcgattctgaagtctagaattgattttagcataagcaactccttgtagcttttgcatctaggtgaattgattc |
349 |
Q |
| |
|
||||||||||| ||||| || || |||| |||| ||||| ||||||||||||||| | |||| |||||||| ||||| ||| ||| |||||||||||| |
|
|
| T |
27910902 |
atgatgtttgggtctctgaagggaaaattgattatgaagcctagaattgattttactagaagctactccttggagcttctgcgtcttcgtgaattgattc |
27911001 |
T |
|
| Q |
350 |
ta |
351 |
Q |
| |
|
|| |
|
|
| T |
27911002 |
ta |
27911003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University