View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306-Insertion-8 (Length: 500)
Name: NF3306-Insertion-8
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306-Insertion-8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 456; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 456; E-Value: 0
Query Start/End: Original strand, 8 - 500
Target Start/End: Complemental strand, 45710043 - 45709541
Alignment:
| Q |
8 |
gttaatgtatagtaattaaactcttgatggtcctatcttgcttaacttgtgtgttt----------gtggtttttatgatggagctagttggggatggca |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45710043 |
gttaatgtatagtaattaaactcttgatggtcctatcttgcttaacttgtgtgttttcgtgtgtttgtggtttttatgatggagctagttggggatggca |
45709944 |
T |
|
| Q |
98 |
agcgcattggagacactttgtgggcaagcttttggggcaaagaaacataacttattaggaatatacctacaaagatcttggattgttctgttcctttgtt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709943 |
agcgcattggagacactttgtgggcaagcttttggggcaaagaaacataacttattaggaatatacctacaaagatcttggattgttctgttcctttgtt |
45709844 |
T |
|
| Q |
198 |
gttttttactgttgccgttttatatctttgccactccaattctcaaacttctaggacaacctgatgacgtggcagaatggagtggtattgtggctatctg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709843 |
gttttttactgttgccgttttatatctttgccactccaattctcaaacttctaggacaacctgatgacgtggcagaatggagtggtattgtggctatctg |
45709744 |
T |
|
| Q |
298 |
gcttataccttcgcatttcagttttgcatctcagtttcctcttcagaggtttctacaatgccagctgaaaacaggtgtgattgcttgggtttctttggtt |
397 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45709743 |
gcttatacctttgcatttcagttttgcatttcagtttcctcttcagaggtttctacaatgccagctgaaaactggtgtgattgcttgggtttctttggtt |
45709644 |
T |
|
| Q |
398 |
ggtttggtggtaaatgtggtgcttagttggctgttgatttttgtttgggattttggacttattggtgctgctattgctttggatgtttcttggtggattt |
497 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709643 |
ggtttggtggtaaatgtggtgcttagttggctgttgatttttgtttgggattttggacttattggtgctgctattgctttggatgtttcttggtggattt |
45709544 |
T |
|
| Q |
498 |
tgg |
500 |
Q |
| |
|
||| |
|
|
| T |
45709543 |
tgg |
45709541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 87 - 174
Target Start/End: Complemental strand, 29112251 - 29112164
Alignment:
| Q |
87 |
tggggatggcaagcgcattggagacactttgtgggcaagcttttggggcaaagaaacataacttattaggaatatacctacaaagatc |
174 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| |||||||| || ||| ||||| || | |||||||||||| | |||||||| |
|
|
| T |
29112251 |
tggggatgggaagcgcattggagacactatgtggacaagctttcggagcagggaaactagacatgttaggaatatacatgcaaagatc |
29112164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 84 - 132
Target Start/End: Complemental strand, 6588342 - 6588294
Alignment:
| Q |
84 |
agttggggatggcaagcgcattggagacactttgtgggcaagcttttgg |
132 |
Q |
| |
|
||||||| |||| ||| |||||||||||||| ||||||||||| ||||| |
|
|
| T |
6588342 |
agttgggtatgggaagtgcattggagacactatgtgggcaagcatttgg |
6588294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University