View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_1D_high_11 (Length: 297)
Name: NF3306_1D_high_11
Description: NF3306_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_1D_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 4 - 175
Target Start/End: Complemental strand, 9064342 - 9064175
Alignment:
| Q |
4 |
tcaagaactgaattgaaaacttatttaattcgcaacccatgaatcattattaaaaatttgggttactaa-nnnnnnngaagggaaggttactaattttta |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
9064342 |
tcaagaactgaattgaaaacttatttaattcgcaacccatgaatcattattaaaaatttgggttactaagtttttttgaagggaaggttactaa-tttta |
9064244 |
T |
 |
| Q |
103 |
atcaaggacatatttatttggttggagctaatttcggttcaccaagcatgtgaggattcagatccaagcatat |
175 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9064243 |
atcaaggaca----tatttggttggagctaatttcagttcaccaagcatgtgaggattcagatccaagcatat |
9064175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 290
Target Start/End: Complemental strand, 9064091 - 9064060
Alignment:
| Q |
259 |
tttctaacaacatacctgtgaaataacaccaa |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9064091 |
tttctaacaacatacctgtgaaataacaccaa |
9064060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University