View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_1D_high_17 (Length: 258)
Name: NF3306_1D_high_17
Description: NF3306_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_1D_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 9149802 - 9149579
Alignment:
| Q |
7 |
taaattatactaggtttttgtaaatattcccatttgactgcttcaacaattaatgtctcaaatttattactcttgcagtagctcagtggaacaaaatcga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9149802 |
taaattatactaggtttttgtaaatattcccatttgactgcttcaacaattaatgtctcaaatttattactcttgcagtagctcagtggaacaaaatcga |
9149703 |
T |
 |
| Q |
107 |
ctaagaatgataacttaaatataagttaaaacagtcattctctaacttcttatggcagcggtgcatacgggcttttctccttcttgtcactacagaaagt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9149702 |
ctaagaatgataacttaaatataagttaaaacagtcattctccaacttcttatggcagcggtgcatacgggcttttctccttcttgtcactacagaaagt |
9149603 |
T |
 |
| Q |
207 |
tggatgttctttaaactgatggga |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
9149602 |
tggatgttctttaaactgatggga |
9149579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University