View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_1D_high_26 (Length: 235)
Name: NF3306_1D_high_26
Description: NF3306_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_1D_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 22 - 234
Target Start/End: Original strand, 9422634 - 9422846
Alignment:
| Q |
22 |
tttttggacagaggtttaagattgatgaagttaatgagagaatgatggaacttagtgggttggttgaacaaggttatgatttgttgggtagtcttaattg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9422634 |
tttttggacagaggtttaagattgatgaagttaatgagagaatgatggaacttagtgggttggttgaacaaggttatgatttgttgggtggtcttaattg |
9422733 |
T |
 |
| Q |
122 |
gggtgatcatcttccatttttgaaagattttgatgttcagaaaatccggttcagttgttctgaattagttcctaaagtgaaccggttcgttggttcaatt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9422734 |
gggtgatcatcttccatttttgaaagattttgatgttcagaaaatccggttcagttgttctgaattagttcctaaagtgaaccggttcgttggttcaatt |
9422833 |
T |
 |
| Q |
222 |
atttccgaacacc |
234 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
9422834 |
atttccgaccacc |
9422846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University