View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_1D_high_29 (Length: 216)
Name: NF3306_1D_high_29
Description: NF3306_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_1D_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 21 - 205
Target Start/End: Original strand, 45596519 - 45596707
Alignment:
| Q |
21 |
gaacgaactgtgtaacgtgtcaaaatatttctcaacgtgggcttctacaattcattttcataatttctctttattttttgacaggagggtg--------t |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45596519 |
gaacgaactgtgtaacgtgtcaaaatatttctcaacgtgggcttctacaattcattttcataatttctctttattttttgacaggagggtggggaaatgt |
45596618 |
T |
 |
| Q |
113 |
gtgacattaatctctcctgtagatggaaagataaaaaacaattcgatcatccattctatgctgtcttccaatagtaagtagatagaagttcat |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45596619 |
gtgacattaatctcttgtgtagatggaaagataaaaaacaattcgatcatccattctatgctgtcttccaatagta----gatagaagttcat |
45596707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University