View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_1D_high_5 (Length: 360)
Name: NF3306_1D_high_5
Description: NF3306_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_1D_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 290; Significance: 1e-163; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 44 - 357
Target Start/End: Original strand, 23332595 - 23332908
Alignment:
| Q |
44 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
143 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
|
| Q |
144 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
|
| Q |
244 |
agctcagcccaaccatcccgcagatagaccttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacataatcat |
343 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332795 |
agctcagcccaaccatcccgcagataaaccttgccatttttcacgtggaccttgaccttgaacatgtttctgtttggatcacgcaacatgacataatcat |
23332894 |
T |
|
| Q |
344 |
caacatgcacacca |
357 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
23332895 |
caacatgcaaacca |
23332908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 23322331 - 23322373
Alignment:
| Q |
7 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
49 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23322331 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 23332498 - 23332540
Alignment:
| Q |
7 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
49 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23332498 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 271 - 357
Target Start/End: Complemental strand, 10955166 - 10955082
Alignment:
| Q |
271 |
accttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacataatcatcaacatgcacacca |
357 |
Q |
| |
|
|||||||| || ||| ||||||||| |||||||||||||| |||| |||||||||| |||||||| |||||||| |||| |||| |
|
|
| T |
10955166 |
accttgcccttcttcttgtggaccttaacctcgaacatgttcttgttaggatcacgca--atgacatagtcatcaacgtgcaaacca |
10955082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 271 - 338
Target Start/End: Original strand, 2027692 - 2027759
Alignment:
| Q |
271 |
accttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacata |
338 |
Q |
| |
|
||||||||||||||| ||| || || ||||| |||||||| |||||||||||||||| |||||||| |
|
|
| T |
2027692 |
accttgccatttttcttgtgaactttaacctcaaacatgttcttgtttggatcacgcaaaatgacata |
2027759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University