View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_1D_low_22 (Length: 266)
Name: NF3306_1D_low_22
Description: NF3306_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_1D_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 2 - 173
Target Start/End: Original strand, 34899804 - 34899975
Alignment:
| Q |
2 |
tttcgtgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgag |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899804 |
tttcatgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgag |
34899903 |
T |
 |
| Q |
102 |
agaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899904 |
agaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
34899975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University