View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_1D_low_32 (Length: 237)
Name: NF3306_1D_low_32
Description: NF3306_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_1D_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 34335689 - 34335458
Alignment:
| Q |
1 |
tccaaaaccaatcatataacatttgtgttcgttgagttcgattttgattcggattaagatacaacttgcatgtatcatgtgatacctaacatttcaagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34335689 |
tccaaaaccaatcatataacatttgtgttcgttgagttcgattttgattcggattaagatacaacttgcatgtatcatgtgatacctaacatt-caagaa |
34335591 |
T |
|
| Q |
101 |
tgaaattactcacatgcagctaactctatttgtgtctggtagataaattccaaaactgctgaaatatctttctcaaacttaagaaacggtccattaggga |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34335590 |
tggaattactcacatgcagctaactctatttgcgtctggtagataaattccaaaactgctgaaatatctttctcaaacttaagaaacggtccattaggga |
34335491 |
T |
|
| Q |
201 |
actccatctttctcagtttacatagtccctccc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34335490 |
actccatctttctcagtttacatagtccctccc |
34335458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University