View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_1D_low_35 (Length: 223)
Name: NF3306_1D_low_35
Description: NF3306_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_1D_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 9 - 114
Target Start/End: Original strand, 8972760 - 8972865
Alignment:
| Q |
9 |
tggtgttgaattcccttaaaaaataattatggtgttgaattttcagttttggtataaatctatattttccaaagatgtcaatatattatgcattccaaat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8972760 |
tggtgttgaattcccttaaaaaataattatggtgttgaattttcagttttggtataaatctatattttccaaagatgtcaacatattatgcattccaaat |
8972859 |
T |
 |
| Q |
109 |
tgttga |
114 |
Q |
| |
|
|||||| |
|
|
| T |
8972860 |
tgttga |
8972865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University