View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_1D_low_41 (Length: 209)
Name: NF3306_1D_low_41
Description: NF3306_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_1D_low_41 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 32154507 - 32154719
Alignment:
| Q |
1 |
aactttgatacattaaaagactatt--ggtcaaaagatatcatcacccttttat---caattaaaaagatgnnnnnnngcactcaagaataaagaagagt |
95 |
Q |
| |
|
|||||||| |||||||||||||||| | | | || ||||||||||||| |||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32154507 |
aactttgacacattaaaagactattatgatgataacatatcatcaccctcttattatcaattaaaaagatgaaaaag-gcactcaagaataaagaagagt |
32154605 |
T |
 |
| Q |
96 |
tggtgattgatatggattagttctcgttgatgtaatgtttcttttactttactcgagggaaagatagacacgctcatcttgctactgtagaaccacgatc |
195 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32154606 |
tggtgattgatatggattagttcttgttgatgtaatgtttcttttactttactcgagggaaagatagacacgctcatcttgctactgtagaaccacgatc |
32154705 |
T |
 |
| Q |
196 |
cacctctcatcgtc |
209 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32154706 |
cacctctcatcgtc |
32154719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University