View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_2D_high_4 (Length: 471)
Name: NF3306_2D_high_4
Description: NF3306_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_2D_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 443; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 443; E-Value: 0
Query Start/End: Original strand, 1 - 455
Target Start/End: Complemental strand, 29319428 - 29318974
Alignment:
| Q |
1 |
gtgtctaacagacacattaattaaggtggttggaagctctctatacaagaagaagatggagatctaccttcaaacacaaaattggatagaaaaagcaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319428 |
gtgtctaacagacacattaattaaggtggttggaagctctctatacaagaagaagatggagatctaccttcaaacacaaaattggatagaaaaagcaaag |
29319329 |
T |
|
| Q |
101 |
ccatttatagcagttttgtttttgcaatttggatatgcaattatggatgttctatcaaaggctgcattgaacagaggaatgagcaactatgtatttgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319328 |
ccatttatagcagttttgtttttgcaatttggatatgcaattatggatgttctatcaaaggctgcattgaacagaggaatgagcaactatgtatttgttg |
29319229 |
T |
|
| Q |
201 |
tgtaccgccatgccgttgcattcattgttataaccccttttgcactctattttgataggtataatcctctctccatctatatgtttgtgttttatttggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319228 |
tgtaccgccatgccgttgcattcattgttataaccccttttgcactctattttgataggtataatcctctctccatctatatgtttgtgttttatttggt |
29319129 |
T |
|
| Q |
301 |
ttggaattcactacttggttcttctttgcaaagtcttaaatttagggagagaaaaatctaaatttgtcaacaatgacccctacaacaaggaccaggtttc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319128 |
ttggaattcactacttggttcttctttgcaaagtcttaaatttagggagagaaaaatctaaatttgtcaacaatgacccctacaacaaggaccaggtttc |
29319029 |
T |
|
| Q |
401 |
cctagctgtattattttcctgcagtttcacgctataatagattgtggccgttcat |
455 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
29319028 |
cctagctgtattattttcctgcagtttcacgttgtaatagattatggccgttcat |
29318974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University