View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_2D_high_8 (Length: 325)
Name: NF3306_2D_high_8
Description: NF3306_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_2D_high_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 19 - 325
Target Start/End: Complemental strand, 31852826 - 31852520
Alignment:
| Q |
19 |
acttggttaatagagatgagaatgagaagctttttgtggcagcattgcacatgccaccttcctctgcctctgctccagtaaatcttgaggttacaacttc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31852826 |
acttggttaatagagatgagaatgagaagctttttgttgcagcattgcacatgccaccttcctctgcctctgctccagtaaatcttgaggttacaacttc |
31852727 |
T |
 |
| Q |
119 |
taacaacattatttgatctattattacatgtgacactagcaatcttaagggacatgattaaatgtgtgacatacatgtattggtgcaggcattttttggg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31852726 |
taacaacattatttgatctattattacatgtgacactagcaatcttaagggacatgattaaatgtgtgacatacatgtattggtgcaggcattttttggg |
31852627 |
T |
 |
| Q |
219 |
cctgcagggcgagacccagaatcagtcctcacagcattcagctccaaagtgctccaagcagcattcaaggtagagtatacccttctataatcaaatataa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31852626 |
cctgcagggcgagacccagaatcagtcctcacagcattcagctccaaagtgctccaagcagcattcaaggtagagtatacccttctataatcaaatataa |
31852527 |
T |
 |
| Q |
319 |
taatttt |
325 |
Q |
| |
|
||||||| |
|
|
| T |
31852526 |
taatttt |
31852520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University