View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_2D_low_31 (Length: 233)
Name: NF3306_2D_low_31
Description: NF3306_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_2D_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 44390821 - 44390597
Alignment:
| Q |
1 |
tgagttggtaccgtgactagctgccaaaatagtggcattagctgaaacacaatcctctattaggggacaggtgcgatcaaggacctgaacacaagattat |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
44390821 |
tgagttggtaccatgactagctgccaaaatagtggcattagctgaaacacaatcctctattaggtgacaggtgtgatcaaggacctgaacacaagattat |
44390722 |
T |
|
| Q |
101 |
gagacatcttgccagagcttgaggtttctatttcaatatgctccatagcacaacaacaaaat----------ctcttgtaataactgatgtaacaattcg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
44390721 |
gagacatcttgccagagcttgaggtttctagttcaatatgctccatagcacaacaacaaaatgttgagaaagctcttgtaatagctgatgtaacaattcg |
44390622 |
T |
|
| Q |
191 |
aaaaatagtgtcaaccattgagttc |
215 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44390621 |
aaaaatagtgtcaaccattgagttc |
44390597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University