View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_2D_low_32 (Length: 232)
Name: NF3306_2D_low_32
Description: NF3306_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_2D_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 107 - 210
Target Start/End: Original strand, 24865455 - 24865558
Alignment:
| Q |
107 |
aacatgcatttaatataattcgatgcggcacttggtcaccccataatacccaacttctatcaattccactcttccaaactcatctagattttcaacttca |
206 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24865455 |
aacatgcattcaatataattcgatgcggcacttggtcaccccataatacccaacttctatcaattccactcttccaaactcatctagattttcaacttca |
24865554 |
T |
|
| Q |
207 |
atag |
210 |
Q |
| |
|
|||| |
|
|
| T |
24865555 |
atag |
24865558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 24864891 - 24864804
Alignment:
| Q |
1 |
agtagcctctaattgaagggtagctaatgctttcttggcttcagtataatgtagctataaagatgggatcttcctcttcttttggatt |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24864891 |
agtagcctctaattgaagggtagctaatgctttcttggcttcagtataatgtagctataaaaatgggatcttcctcttcttttggatt |
24864804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University