View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_high_15 (Length: 315)
Name: NF3306_high_15
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 191 - 295
Target Start/End: Original strand, 17471401 - 17471505
Alignment:
| Q |
191 |
tctataaaaccagcttataataaggcgagatatgtctcccaccttatgataaatagagttttcaaattatatttaatttgacgtgagactcccaacacac |
290 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17471401 |
tctataaaaccagcttgtaataaggtgagatatgtctcccaccttatgataaatagagtttttaaattatatttaatttgacgtgagactctcaacacac |
17471500 |
T |
|
| Q |
291 |
tactt |
295 |
Q |
| |
|
||||| |
|
|
| T |
17471501 |
tactt |
17471505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 57 - 142
Target Start/End: Original strand, 17471262 - 17471346
Alignment:
| Q |
57 |
agtaaatagtgccgtttggtttgttgaatatttttttagtagttattttnnnnnnnnnttaatagttatgttttctatgataagca |
142 |
Q |
| |
|
||||| ||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
17471262 |
agtaattagtgccgtttggtttgatgaatacttttttagtagttatttt-tttaaaaattaatagttatgtttgctatgataagca |
17471346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University