View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_high_19 (Length: 298)
Name: NF3306_high_19
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 283
Target Start/End: Original strand, 51222651 - 51222928
Alignment:
| Q |
10 |
gcagagataatcttttggttgattcttcatgatttttggttggatttatggttgattttgtcttttcattgttcatttcctgtctttcttcattttatcg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51222651 |
gcagagataatcttttggttgattcttcatgatttttggttggatttatggttgattttgtcttttcattgttcattttctgtctttcttcattttatcg |
51222750 |
T |
|
| Q |
110 |
ttgttattgataggatgtcacgtatacttcatatcttt----nnnnnnnnnnnnnatgtgagtattgcattcatgccaaaaatataactatgtatccttt |
205 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222751 |
ttgttattgataggatgtcacatatacttcatatcttttgtgtgtgtgtgtgtgtatgtgagtattgcattcatgccaaaaatataactatgtatccttt |
51222850 |
T |
|
| Q |
206 |
gaaaacaacttcaattgaatgcaatattgcgctatctaattcaatcaaaatatatagaagaactaatgcatgagtaat |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222851 |
gaaaacaacttcaattgaatgcaatattgcgctatctaattcaatcaaaatatatagaagaactaatgcatgagtaat |
51222928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 48 - 86
Target Start/End: Original strand, 51222430 - 51222468
Alignment:
| Q |
48 |
gttggatttatggttgattttgtcttttcattgttcatt |
86 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
51222430 |
gttggatgtatggttgattttgtcttttcattgtccatt |
51222468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University