View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_high_35 (Length: 245)
Name: NF3306_high_35
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 24499726 - 24499611
Alignment:
| Q |
1 |
atatttgctgttactcgtacgataaggtgccaaaattctcttattctatgtgcccaaaataatcaatttcatgatttttgtcacactactcttgttatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24499726 |
atatttgctgttactcgtacgataaggtgccaaaattctcttattctatgtgcccaaaataatcaatttcatgatttttgtcac---actcttgttatca |
24499630 |
T |
 |
| Q |
101 |
tcacttaattacatgcact |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24499629 |
tcacttaattacatgcact |
24499611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 183 - 232
Target Start/End: Complemental strand, 24499543 - 24499494
Alignment:
| Q |
183 |
taaaattcattgtattgaaagtgttttatttttgtacgtagataatattg |
232 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24499543 |
taaaattcattgtgttgaaagtgttttatttttgtaagtagataatattg |
24499494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University