View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_high_38 (Length: 238)
Name: NF3306_high_38
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_high_38 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 44670602 - 44670845
Alignment:
| Q |
1 |
aaggatagccaagtataaagttcacagcgtggaagggaaagttaaagctacactcaagaaaggacttcgatggatcaagaaaaaatgctctcaaatcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44670602 |
aaggatagccaagtataaagttcacagcgtggaagggaaagttaaagctacactcaagaaaggacttcgatggatcaagaaaaaatgctctcaaatcact |
44670701 |
T |
 |
| Q |
101 |
catggctactaatag------ctagtacttttattcaatgtacaaatgcattaatgttacggtcatcaatatctgataatgcattgtatatgcttttgtt |
194 |
Q |
| |
|
||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44670702 |
catggctactaatagtaatagctattacttttatgcaatgtacaaatgcattaatgttacggtcatcaatatctgataatgcattgtatatgcttttgtt |
44670801 |
T |
 |
| Q |
195 |
ttactcttatctcatgtatgcattcttgaaaacatttgtgctaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44670802 |
ttactcttatctcatgtatgcattcttgaaaacatttgtgctaa |
44670845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University