View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_low_15 (Length: 354)
Name: NF3306_low_15
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 38040212 - 38040462
Alignment:
| Q |
1 |
aaaatcaacaacctcaagaagggtttgaaatggaaaatcccccaattgaaaccctagaaaatgatgcaaatgaaagaaattcggttggatccaacgcggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38040212 |
aaaatcaacaacctcaagaagggtttgaaatggaaaatcccccaattgaaaccctagaaaatgatgcaaatgaaagaaattcggttggatccaacgcggg |
38040311 |
T |
|
| Q |
101 |
acaacagaataatgatctgagtaagaaggtttctgctattatttctgatcctgatgttcttgattgcttcatttgctctgaaccgttggcagttcctatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38040312 |
acaacagaataatgatctgagtaagaaggtttctgctatcatttctgatcctgatgttcttgattgcttcatttgctctgaaccgttggcagttcctatt |
38040411 |
T |
|
| Q |
201 |
tatcaggttagttgctcttctgggtgttctgttttgactagaaagcttgaa |
251 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38040412 |
tatcaggttagtttctcttctgggtgttctgttttgactagaaatcttgaa |
38040462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 278 - 339
Target Start/End: Original strand, 38040489 - 38040550
Alignment:
| Q |
278 |
gtatgaattatttgatttgtgatggaagatttaggttagtgattttattgtgagttggaatt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38040489 |
gtatgaattatttgatttgtgatggaagatttaggttagtgattttattgtgagttggaatt |
38040550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University