View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_low_21 (Length: 299)
Name: NF3306_low_21
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 4 - 281
Target Start/End: Complemental strand, 34335734 - 34335458
Alignment:
| Q |
4 |
atcatcactacctgctcaaattcaagttnnnnnnnntgtaatttctccaaaaccaatcatataacatttgtgttcgttgagttcgattttgattcggatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34335734 |
atcatcactacctgctcaaattcaagttaaaaaaaatgtaatttctccaaaaccaatcatataacatttgtgttcgttgagttcgattttgattcggatt |
34335635 |
T |
 |
| Q |
104 |
aagatacaacttgcatgtatcatgtgatacctaacatttcaagaatgaaattactcacatgcagctaactctatttgtgtctggtagataaattccaaaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34335634 |
aagatacaacttgcatgtatcatgtgatacctaacatt-caagaatggaattactcacatgcagctaactctatttgcgtctggtagataaattccaaaa |
34335536 |
T |
 |
| Q |
204 |
ctgctgaaatatctttctcaaacttaagaaacggtccattagggaactccatctttctcagtttacatagtccctccc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34335535 |
ctgctgaaatatctttctcaaacttaagaaacggtccattagggaactccatctttctcagtttacatagtccctccc |
34335458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University