View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_low_23 (Length: 294)
Name: NF3306_low_23
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 45647551 - 45647273
Alignment:
| Q |
1 |
ctactattttaattattctgtctctcttccttccaagtcttctcttggtataaataatcaatgcccaccaccacttcattccaactcatcattcaaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45647551 |
ctactattttaattattctgtctctcttccttccaagtcttctcttggtataaataatcaatgcccaccaccacttcattccaactcatcattcaaattg |
45647452 |
T |
|
| Q |
101 |
tttcnnnnnnngtcttgcccgtaacatataattggttttcaaaagtctccggttaatttgtttgtcaccgatcttaacaaatgatgaagatcatcgcagt |
200 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45647451 |
ttcctttttttgtcttgcccgtaacatataattggttttcaaaagtctccggttaatttgtttgtcaccgatcttaacaaatgatgaagatcatcgcagt |
45647352 |
T |
|
| Q |
201 |
gttgctgcttctggtgttaaccaccactgtcactgctgatcccgataatcttcaagacctctgtgttgcagaccttgct |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45647351 |
gttgctgcttctggtgttaaccaccactgtcactgctgatcccgataatcttcaagacctctgtgttgcagaccttgct |
45647273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University