View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_low_26 (Length: 288)
Name: NF3306_low_26
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 274
Target Start/End: Complemental strand, 36009415 - 36009154
Alignment:
| Q |
10 |
aagaatattctcggcatatctctctcattgacacctctttaataacatatgttttccactcgttttgttctccttaattaactcgtttaccattgtgttt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
36009415 |
aagaatattctcggcatatctctctcattgacacctctttaataacatatgttttccactcgtttcgttctccttaattaactcgtttaccatcgtgttt |
36009316 |
T |
 |
| Q |
110 |
tgcatccctgtcggtatgacacttgtcgcataggctctcccatcgtgcctaattcagattaattaagaaccaaaaagtaacttaagaatcaaaattgtaa |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36009315 |
tgcatccctgtcgatatgacacttgtcgcataggctctcccatcgtccctaattcagattaattaagaaccaaaaagtaacttaagaatcaaaattgtaa |
36009216 |
T |
 |
| Q |
210 |
tttattcaaaatataataagttaaaacaccaaacttcaaagttaatcaacaatgttgtcataact |
274 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36009215 |
tttattcaaaat---ataagttaaaacaccaaacttcaaagttaatcaacaatgttgtcataact |
36009154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 96 - 148
Target Start/End: Complemental strand, 18055130 - 18055078
Alignment:
| Q |
96 |
ttaccattgtgttttgcatccctgtcggtatgacacttgtcgcataggctctc |
148 |
Q |
| |
|
||||||| |||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
18055130 |
ttaccatcatgtttttcatccccgtcggtacgacacttgtcgcataggctctc |
18055078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University