View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_low_34 (Length: 249)
Name: NF3306_low_34
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 11 - 237
Target Start/End: Original strand, 24499943 - 24500169
Alignment:
| Q |
11 |
ggcgttgaagaaaatcggtttaccttcttctcgaccaattttttataatctattctaaatggttctaaactatatataaaagcaatattagggttacttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24499943 |
ggcgttgaagaaaatcggtttaccttcttctcgaccaattttttataatctattctaaatggttctaaactatatataaaagcaatattagggttacttt |
24500042 |
T |
 |
| Q |
111 |
ttcccttcaaattatatctttaaacaaatttgacctataataatggaatatagttggtgtgtttcaaaaagattaaaatcttttgnnnnnnnaaggaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| ||| | | ||| |
|
|
| T |
24500043 |
ttcccttcaaattatatctttaaacaaatttgacctataataatggaatatagttgatgtctttcaaaaagattagaatcctttattttttttaaggaaa |
24500142 |
T |
 |
| Q |
211 |
aagattagaacttgtatttgttatatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
24500143 |
aagattagaacttgtatttgttatatt |
24500169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University