View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_low_46 (Length: 220)
Name: NF3306_low_46
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 53911425 - 53911236
Alignment:
| Q |
15 |
cacagatggagacagttaaagctggaaacaaaggctacggtgctgagattgcggtggttacttattgcaagggaaagagagatagccccgagaagccaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53911425 |
cacagatggagacagttaaagctggaaacaaaggctacggtgctgagattgcggtggttacttattgcaagggaaagagagatagccccgagaagccaaa |
53911326 |
T |
|
| Q |
115 |
gcttcggatccttcttgtaagatttattgctattgcttttattaacaaacttttgtttcacaaattgtttattgtcgccaataactgtat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53911325 |
gcttcggatccttcttgtaagatttattgctattgtttttattaacaaacttttgtttcacaaattgtttattgtcgccaataactgtat |
53911236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University