View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3306_low_50 (Length: 202)
Name: NF3306_low_50
Description: NF3306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3306_low_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 20 - 184
Target Start/End: Original strand, 37644096 - 37644259
Alignment:
| Q |
20 |
ctcaactgctctgataatcaaatgcaagtgccatagcgttgcaagaaaggagaaaaggtcgccgtaataaagccgtagttcacgtctggcgttacggttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37644096 |
ctcaactgctctgataatcaaatgcaagtgccatagcgttgcaagaaaggagaaaaggtcgccgtaataaagccgtcgttcacgtctggcgttacggttg |
37644195 |
T |
 |
| Q |
120 |
ttatgtgccttaatgtgtcggtccggagcggttaattagcgtgtatggacggaacggtggctaag |
184 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
37644196 |
ttatgtgctctaatgtgttggtccggagcggttaattagtgtgtatgga-gggacggtggctaag |
37644259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University