View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3307_high_30 (Length: 259)

Name: NF3307_high_30
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3307_high_30
NF3307_high_30
[»] chr7 (1 HSPs)
chr7 (108-244)||(38037994-38038130)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 108 - 244
Target Start/End: Complemental strand, 38038130 - 38037994
Alignment:
108 gtagccatgatcatagattaaggcacaaactttaatgttgaggcaactttgatgaaaagatgctgggcaactatcgcagcaaatcaactctcctccgtct 207  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||||||||    
38038130 gtagccatgatcatagattaaggcacaaactttaatgttgagacaactttgatgaaaagctgctggacaactatcgcagcaaatcaactctcctccgtct 38038031  T
208 ttacaaacaccacatgactcttcgttaaggtctttat 244  Q
    |||||||||||||||||||||||||||||||||||||    
38038030 ttacaaacaccacatgactcttcgttaaggtctttat 38037994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University