View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3307_high_31 (Length: 253)

Name: NF3307_high_31
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3307_high_31
NF3307_high_31
[»] chr1 (1 HSPs)
chr1 (1-247)||(10132812-10133058)


Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 10133058 - 10132812
Alignment:
1 tcttgatgctatagtatatatatgatttaaattttgaaatttatgctttcatgtgtttatatgcatgactctggaacttgcatatttttcaatactttaa 100  Q
    |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10133058 tcttgatgctatggtatatatatgatttaaaatttgaaatttatgctttcatgtgtttatatgcatgactctggaacttgcatatttttcaatactttaa 10132959  T
101 gaataggttaggaatttcacatgagannnnnnnggttaaacatgttattactttattggggtaaagtattactgtctgtttttgccacctttagtagtta 200  Q
    ||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
10132958 gaataggttaggaatttcacatgagatttttttggttaaacatgttattactttattggggtaaagtattacagtctgtttttgccacctttagtagtta 10132859  T
201 ttatgctcggaactatgactgaccatctttagtggagtctctgctcc 247  Q
     ||||||| ||||||||||||||||||||||||||| ||||||||||    
10132858 ctatgctcagaactatgactgaccatctttagtggaatctctgctcc 10132812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University