View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3307_high_31 (Length: 253)
Name: NF3307_high_31
Description: NF3307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3307_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 10133058 - 10132812
Alignment:
| Q |
1 |
tcttgatgctatagtatatatatgatttaaattttgaaatttatgctttcatgtgtttatatgcatgactctggaacttgcatatttttcaatactttaa |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10133058 |
tcttgatgctatggtatatatatgatttaaaatttgaaatttatgctttcatgtgtttatatgcatgactctggaacttgcatatttttcaatactttaa |
10132959 |
T |
|
| Q |
101 |
gaataggttaggaatttcacatgagannnnnnnggttaaacatgttattactttattggggtaaagtattactgtctgtttttgccacctttagtagtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10132958 |
gaataggttaggaatttcacatgagatttttttggttaaacatgttattactttattggggtaaagtattacagtctgtttttgccacctttagtagtta |
10132859 |
T |
|
| Q |
201 |
ttatgctcggaactatgactgaccatctttagtggagtctctgctcc |
247 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10132858 |
ctatgctcagaactatgactgaccatctttagtggaatctctgctcc |
10132812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University